Onyx Embolization of Distal Middle Cerebral Artery Aneurysm in a Patient with Nontraumatic Subdural Hematoma.

Onyx Embolization of Distal Middle Cerebral Artery Aneurysm in a Patient with Nontraumatic Subdural Hematoma.

Distal cortical center cerebral artery (MCA) aneurysm is a uncommon entity. Despite the difficult process, the position of endovascular remedy is rising because of its security and efficacy in obliterating the microaneurysm. We report a 25-year-old male, who offered with a historical past of dizziness and headache for nearly 2 weeks.

Computed tomography scan confirmed a proper entrance parietal subdural hematoma (SDH). We couldn’t establish any underlying defining etiology of SDH neither head damage nor coagulopathy dysfunction. Therefore, diagnostic cerebral angiogram was carried out, which confirmed a microaneurysm in the distal proper MCA cortical department.

Hence, full obliteration of this microaneurysm was carried out utilizing Onyx for endovascular embolization. Therefore, this case report demonstrates the efficacy of this modality in the remedy of microaneurysms with SDH

Onyx Embolization of Distal Middle Cerebral Artery Aneurysm in a Patient with Nontraumatic Subdural Hematoma.
Onyx Embolization of Distal Middle Cerebral Artery Aneurysm in a Patient with Nontraumatic Subdural Hematoma.

 To report a uncommon complication that Onyx gel blocked the MCA trunk and branches unexpectedly throughout AVM embolism and our technique to rescue. Material and strategies: A 16 years outdated in any other case wholesome lady maintain a left facet Spetzler – Martin grade III fronto-temporal AVM, throughout embolization, the L-MCA and its branches have been blocked by Onyx fully, the affected person was transferred to the working room to extract the Onyx gel instantly.

 Result: After completely 10 arterotomies, all of the Onyx gel have been eliminated. eight hours after occlusion, all arteries have been then seen to pulsate. 

Conclusion: Iatrogenic MCA full-length acute occlusion is a uncommon and extreme complication throughout AVM embolism. Carefully establish the feeding arteries, micro-catheter angiography earlier than Onyx gel injection and balloon-assisted embolism may in all probability stop it. Surgical operation to extract onyx gel and re-canalize MCA was really helpful, AVM needs to be resect if potential.

TRIM25 antibody

70R-20982 50 ul
EUR 435
Description: Rabbit polyclonal TRIM25 antibody

TRIM25 Antibody

43160-100ul 100ul
EUR 252

TRIM25 Antibody

1-CSB-PA054075
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TRIM25. Recognizes TRIM25 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:10-1:50

TRIM25 Antibody

1-CSB-PA060115
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TRIM25. Recognizes TRIM25 from Human. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000

TRIM25 Antibody

1-CSB-PA617909LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TRIM25. Recognizes TRIM25 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200

TRIM25 Antibody

CSB-PA997812-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against TRIM25. Recognizes TRIM25 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

TRIM25 Antibody

CSB-PA997812-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against TRIM25. Recognizes TRIM25 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

TRIM25 Antibody

1-CSB-PA172995
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TRIM25. Recognizes TRIM25 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:30-1:150

TRIM25 Antibody

1-CSB-PA024461GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against TRIM25. Recognizes TRIM25 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF

TRIM25 siRNA

20-abx938029
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TRIM25 siRNA

20-abx938030
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-TRIM25

YF-PA15423 50 ug
EUR 363
Description: Mouse polyclonal to TRIM25

anti-TRIM25

YF-PA15424 100 ul
EUR 403
Description: Rabbit polyclonal to TRIM25

anti-TRIM25

YF-PA15425 100 ug
EUR 403
Description: Rabbit polyclonal to TRIM25

anti-TRIM25

YF-PA24996 50 ul
EUR 334
Description: Mouse polyclonal to TRIM25

E3 Ubiquitin/ISG15 Ligase TRIM25 (TRIM25) Antibody

abx224319-100ug 100 ug
EUR 411
  • Shipped within 5-10 working days.

TRIM25 Rabbit pAb

A12938-100ul 100 ul
EUR 308

TRIM25 Rabbit pAb

A12938-200ul 200 ul
EUR 459

TRIM25 Rabbit pAb

A12938-20ul 20 ul
EUR 183

TRIM25 Rabbit pAb

A12938-50ul 50 ul
EUR 223

TRIM25 Blocking Peptide

20-abx061223
  • EUR 286.00
  • EUR 425.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

TRIM25 Conjugated Antibody

C43160 100ul
EUR 397

Polyclonal TRIM25 Antibody

APR06458G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TRIM25 . This antibody is tested and proven to work in the following applications:

Polyclonal TRIM25 Antibody

APR06459G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TRIM25 . This antibody is tested and proven to work in the following applications:

TRIM25 Antibody (HRP)

20-abx315016
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

TRIM25 Antibody (FITC)

20-abx315017
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

TRIM25 Antibody (Biotin)

20-abx315018
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

TRIM25 cloning plasmid

CSB-CL617909HU-10ug 10ug
EUR 640
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1893
  • Sequence: atggcagagctgtgccccctggccgaggagctgtcgtgctccatctgcctggagcccttcaaggagccggtcaccactccgtgcggccacaacttctgcgggtcgtgcctgaatgagacgtgggcagtccagggctcgccatacctgtgcccgcagtgccgcgccgtctaccagg
  • Show more
Description: A cloning plasmid for the TRIM25 gene.

TRIM25 Rabbit mAb

A4347-100ul 100 ul
EUR 410

TRIM25 Rabbit mAb

A4347-200ul 200 ul
EUR 571

TRIM25 Rabbit mAb

A4347-20ul 20 ul
EUR 221

TRIM25 Rabbit mAb

A4347-50ul 50 ul
EUR 287

anti- TRIM25 antibody

FNab08976 100µg
EUR 585
  • Recommended dilution: WB: 1:200-1:2000
  • IP: 1:200-1:2000
  • IF: 1:20-1:200
  • Immunogen: tripartite motif-containing 25
  • Uniprot ID: Q14258
  • Gene ID: 7706
  • Research Area: Epigenetics, Immunology, Metabolism
Description: Antibody raised against TRIM25

Anti-TRIM25 antibody

PAab08976 100 ug
EUR 412

pCAGGS-HA-TRIM25

PVT14013 2 ug
EUR 599

Anti-TRIM25 antibody

STJ11100763 100 µl
EUR 413
Description: The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The protein localizes to the cytoplasm. The presence of potential DNA-binding and dimerization-transactivation domains suggests that this protein may act as a transcription factor, similar to several other members of the TRIM family. Expression of the gene is upregulated in response to estrogen, and it is thought to mediate estrogen actions in breast cancer as a primary response gene.

Anti-TRIM25 antibody

STJ114804 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The protein localizes to the cytoplasm. The presence of potential DNA-binding and dimerization-transactivation domains suggests that this protein may act as a transcription factor, similar to several other members of the TRIM family. Expression of the gene is upregulated in response to estrogen, and it is thought to mediate estrogen actions in breast cancer as a primary response gene.

Anti-TRIM25 (5C3)

YF-MA11023 100 ug
EUR 363
Description: Mouse monoclonal to TRIM25

Anti-TRIM25 (2B12)

YF-MA16180 100 ug
EUR 363
Description: Mouse monoclonal to TRIM25

Anti-TRIM25 (5F12)

YF-MA16181 100 ug
EUR 363
Description: Mouse monoclonal to TRIM25

Mouse E3 ubiquitin/ISG15 ligase TRIM25, Trim25 ELISA KIT

ELI-29036m 96 Tests
EUR 865

Human E3 ubiquitin/ISG15 ligase TRIM25, TRIM25 ELISA KIT

ELI-40165h 96 Tests
EUR 824

TRIM25 Antibody, HRP conjugated

1-CSB-PA617909LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TRIM25. Recognizes TRIM25 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

TRIM25 Antibody, FITC conjugated

1-CSB-PA617909LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TRIM25. Recognizes TRIM25 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

TRIM25 Antibody, Biotin conjugated

1-CSB-PA617909LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TRIM25. Recognizes TRIM25 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Polyclonal TRIM25 Antibody (Center)

APR04146G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TRIM25 (Center). This antibody is tested and proven to work in the following applications:

TRIM25 ELISA KIT|Human

EF003821 96 Tests
EUR 689

Human TRIM25 shRNA Plasmid

20-abx955224
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse TRIM25 shRNA Plasmid

20-abx981073
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Anti-TRIM25 Monoclonal Antibody

M03232 100ug
EUR 397
Description: Rabbit Monoclonal TRIM25 Antibody. Validated in IP, IF, WB and tested in Human, Mouse, Rat.

TRIM25 Recombinant Protein (Rat)

RP234665 100 ug Ask for price

pECMV-3-FLAG-TRIM25

PVT12769 2 ug
EUR 703

TRIM25 Recombinant Protein (Human)

RP032893 100 ug Ask for price

TRIM25 Recombinant Protein (Mouse)

RP181088 100 ug Ask for price

Polyclonal TRIM25 Antibody (C-Terminus)

APR02517G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TRIM25 (C-Terminus). This antibody is tested and proven to work in the following applications:

[KO Validated] TRIM25 Rabbit pAb

A19887-100ul 100 ul
EUR 410

[KO Validated] TRIM25 Rabbit pAb

A19887-200ul 200 ul
EUR 571

[KO Validated] TRIM25 Rabbit pAb

A19887-20ul 20 ul
EUR 221

[KO Validated] TRIM25 Rabbit pAb

A19887-50ul 50 ul
EUR 287

Trim25 ORF Vector (Rat) (pORF)

ORF078223 1.0 ug DNA
EUR 506

TRIM25 ORF Vector (Human) (pORF)

ORF010965 1.0 ug DNA
EUR 95

Trim25 ORF Vector (Mouse) (pORF)

ORF060364 1.0 ug DNA
EUR 506

Tripartite Motif Containing 25 (TRIM25) Antibody

20-abx004556
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Tripartite Motif Containing 25 (TRIM25) Antibody

20-abx210308
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Tripartite Motif-Containing 25 (TRIM25) Antibody

20-abx116274
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Tripartite Motif Containing 25 (TRIM25) Antibody

20-abx133641
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Tripartite Motif Containing 25 (TRIM25) Antibody

abx029113-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Tripartite Motif Containing 25 (TRIM25) Antibody

abx029113-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Tripartite Motif Containing 25 (TRIM25) Antibody

abx238976-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Tripartite Motif Containing 25 (TRIM25) Antibody

20-abx339143
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Tripartite Motif Containing 25 (TRIM25) Antibody

abx331231-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Tripartite Motif Containing 25 (TRIM25) Antibody

20-abx324422
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Tripartite Motif Containing 25 (TRIM25) Antibody

abx224437-100ug 100 ug
EUR 411
  • Shipped within 5-10 working days.

Tripartite Motif Containing 25 (TRIM25) Antibody

20-abx302574
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Trim25 sgRNA CRISPR Lentivector set (Rat)

K7502401 3 x 1.0 ug
EUR 339

TRIM25 sgRNA CRISPR Lentivector set (Human)

K2465001 3 x 1.0 ug
EUR 339

Trim25 sgRNA CRISPR Lentivector set (Mouse)

K4121801 3 x 1.0 ug
EUR 339

Monoclonal TRIM25 Antibody (monoclonal) (M02), Clone: 5F12

AMM04246G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human TRIM25 (monoclonal) (M02). The antibodies are raised in mouse and are from clone 5F12. This antibody is applicable in WB and IF

Monoclonal TRIM25 Antibody (monoclonal) (M03), Clone: 5C3

AMM04247G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human TRIM25 (monoclonal) (M03). The antibodies are raised in mouse and are from clone 5C3. This antibody is applicable in WB, IHC and IF

Trim25 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7502402 1.0 ug DNA
EUR 154

Trim25 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7502403 1.0 ug DNA
EUR 154

Trim25 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7502404 1.0 ug DNA
EUR 154

TRIM25 sgRNA CRISPR Lentivector (Human) (Target 1)

K2465002 1.0 ug DNA
EUR 154

TRIM25 sgRNA CRISPR Lentivector (Human) (Target 2)

K2465003 1.0 ug DNA
EUR 154

TRIM25 sgRNA CRISPR Lentivector (Human) (Target 3)

K2465004 1.0 ug DNA
EUR 154

Trim25 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4121802 1.0 ug DNA
EUR 154

Trim25 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4121803 1.0 ug DNA
EUR 154

Trim25 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4121804 1.0 ug DNA
EUR 154

TRIM25 Protein Vector (Rat) (pPB-C-His)

PV312890 500 ng
EUR 603

TRIM25 Protein Vector (Rat) (pPB-N-His)

PV312891 500 ng
EUR 603

TRIM25 Protein Vector (Rat) (pPM-C-HA)

PV312892 500 ng
EUR 603

TRIM25 Protein Vector (Rat) (pPM-C-His)

PV312893 500 ng
EUR 603

TRIM25 Protein Vector (Mouse) (pPB-C-His)

PV241454 500 ng
EUR 603

TRIM25 Protein Vector (Mouse) (pPB-N-His)

PV241455 500 ng
EUR 603

TRIM25 Protein Vector (Mouse) (pPM-C-HA)

PV241456 500 ng
EUR 603

TRIM25 Protein Vector (Mouse) (pPM-C-His)

PV241457 500 ng
EUR 603

TRIM25 Protein Vector (Human) (pPB-C-His)

PV043857 500 ng
EUR 329

TRIM25 Protein Vector (Human) (pPB-N-His)

PV043858 500 ng
EUR 329

TRIM25 Protein Vector (Human) (pPM-C-HA)

PV043859 500 ng
EUR 329

TRIM25 Protein Vector (Human) (pPM-C-His)

PV043860 500 ng
EUR 329

Trim25 3'UTR Luciferase Stable Cell Line

TU121085 1.0 ml Ask for price

Trim25 3'UTR GFP Stable Cell Line

TU171085 1.0 ml Ask for price

Trim25 3'UTR Luciferase Stable Cell Line

TU222431 1.0 ml Ask for price

TRIM25 3'UTR GFP Stable Cell Line

TU076534 1.0 ml
EUR 2333

TRIM25 3'UTR Luciferase Stable Cell Line

TU026534 1.0 ml
EUR 2333

Trim25 3'UTR GFP Stable Cell Line

TU272431 1.0 ml Ask for price

TRIM25 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV638401 1.0 ug DNA
EUR 682

TRIM25 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV638405 1.0 ug DNA
EUR 682

TRIM25 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV638406 1.0 ug DNA
EUR 682

Human Tripartite Motif-Containing Protein 25 (TRIM25) ELISA Kit

abx383926-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Trim25 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K7502405 3 x 1.0 ug
EUR 376

TRIM25 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K2465005 3 x 1.0 ug
EUR 376

Trim25 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K4121805 3 x 1.0 ug
EUR 376

TRIM25 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV638402 1.0 ug DNA
EUR 682

TRIM25 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV638403 1.0 ug DNA
EUR 740

TRIM25 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV638404 1.0 ug DNA
EUR 740

Trim25 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K7502406 1.0 ug DNA
EUR 167

Trim25 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K7502407 1.0 ug DNA
EUR 167

Trim25 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K7502408 1.0 ug DNA
EUR 167

TRIM25 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K2465006 1.0 ug DNA
EUR 167

TRIM25 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K2465007 1.0 ug DNA
EUR 167

TRIM25 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K2465008 1.0 ug DNA
EUR 167

Trim25 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K4121806 1.0 ug DNA
EUR 167

Trim25 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K4121807 1.0 ug DNA
EUR 167

Trim25 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K4121808 1.0 ug DNA
EUR 167

Leave a Comment

Your email address will not be published. Required fields are marked *

Scroll to Top